Date: Thu Apr 13 12:39:34 2000
To: webartery@egroups.com
From: Ted Warnell <warnell@memlane.com>
Subject: real people

Cc: Bcc: X-Attachments: In-Reply-To: References:

> ...that our language re[de]fine.ment will correspond more
> closely 2 the very incremental institutionalized learning/methods of
> societal reproduction techniquez [eg n-sert industrial rev/printing press
> para[mount].lellz here] rather than a linear/narrative structure that we
> currentlee writhe under...

  Think so, too, Mez, and bring it on! If so, it means our art/poetry
  will achieve that oft expressed aim of the creatives -- to actually
  reach, touch, and influence 'real people'. Let it hang in galleries
  and museums, team change rooms, corporate board rooms, on the walls
  behind cash tills at the 7-11 and Macs, in waiting rooms, and on to
  playing cards, matchbox covers, posters, billboards, TV, video, and
  wherever real people conduct the activities of real life.

  .18568-100000@        .  .        .   >R         :<3.0.6.
   :X-A          :I -R    -T :<P   .GSO.4.10.10004131037590
    :T  W      <       @       .   >S      :          C :B
  F   ???@???T  A  1311:01:552000T :         @       .   F
  32.20000412082155.00 9   0@          .       .   .  >

  I go in to my dentist's office and take a place in a blue
  waiting room that smells like thinly veiled pain and look
  at lovely reproductions and prints of the Impressionists.

  And, I think, Gertrude and the gang must have sat in a room such as
  this, but with originals rather than repros, and without the smell.

  And likely without the plastic model of a cut-away tooth.

  >...              e e[ e]   e. e          e        e>
      >    e    e           e      e [e  - e             e
  /          e  >    [     ]. e    e e]    e         e  /
      e  2  e e      e e                   e  e      / e
        e        e     e>    e   ee     e   e ...

  And, I'm thinking, what would the gang think to see this?
  What's on AltaVista Now? Monet? Stein? Arts and poetries?

                NOW: Tick-Tock: Last-minute tips and tricks
                CSCO NASD   64.44  69951102  - 0.56 - 0.87%
                GDT  NYSE   55.25   2978200  - 9.75 -15.00%
                INTC NASD  127.63  32234801  + 5.75 + 4.71%
                MSFT NASD   81.38    123800  + 2.00 + 2.51%
                SFO  AMEX   72.00    342200  - 8.50 -10.56%
                SUNW NASD   83.00  22083699  + 3.00 + 3.75%
                WEBM NASD  117.31  21318699  -23.69 -16.80%

                NOW: Your DNA: Thinking Small, Thinking Big
  TTGATATTGGGTTTGACCCCAGTCCCAAGAGGCACCGATATGAAAGGCGTCGATATG
  TTGGCCGTCACAGATATGAACGAGATGTTGGGTACCGGCAAGTTGATATTGGGTTTG
  ACCCCAGTCCCAAGAGGCACCGATATGAAAGGCGTCGATATGTTGGCCGTCACAGAT
  ATGAACGAGATGTTGGGTACCGGCAAGTTGATATTGGGTTTGACCCCAGTCCCAAGA
  GGCACCGATATGAAAGGCGTCGATATGTTGGCCGTCACAGATATGAACGAGATGTTG
  GGTACCGGCAAGTTGATATTGGGTTTGACCCCAGTCCCAAGAGGCACCGATATGAAA
  GGCGTCGATATGTTGGCCGTCACAGATATGAACGAGATGTTGGGTACCGGCAAGTTG
                                                      Think
               Macs in       rooms and           cards
   influence real        Let                    museums
         rooms corporate     rooms on
    Mez and       on If             art poetry
                        creatives  to        reach touch
      covers posters billboards TV video and
                              life
                         AGGC AMEX   64.44  language  - 0.56  - 0.87%
                         ATGC NASD   55.25 [de]fine.  - 9.75  -15.00%
                         GATA NASD   81.38    .lellz  + 2.00  + 2.51%
                         GGCC NASD   72.00   e e[ e]  - 8.50  -10.56%
                         TATG NYSE  117.31  -100000@  -23.69  -16.80%
                         CACG NASD  127.63 eg n-sert  + 5.75  + 4.71%
                         GGGT NASD   83.00  A 1311:0  + 3.00  + 3.75%
                                                      - 0.44
                                                      +16.85
                                                      + P.bN